Getting Started with Genotator

Genotator is a program that allows you to perform a variety of different sequence analyses[1] at once and examine the various outputs in a unified form. Additional information about Genotator and the details about its functions and usage can be found at http://www.fruitfly.org/~nomi/genotator/.

This HOWTO covers getting started with using Genotator and running a typical analysis. For details and in depth discussion on subsequent examination of the results, please consult the documentation provided at the site linked above.

Note: Genotator requires an X-Windows connection to our servers. Please see our XWin HOWTO for details.

Running the analysis

Genotator runs in two stages - first the analysis, then the examination of the analysis. To run an analysis, prepare your sequence in fasta format. It should look something like this:

>MyDrosSeq
agttgtactgaaatactcgataaggaaatacccaaattacaaaatgttcaagcacctgctgactttgttc
gccctgtgcgcggtgtttagcacctgcctgtcggaagacgagacccgtgcccgtctcctggtctctaagc
agatcctgaacaagtacctggtggagaagagcgacctgttggtacgctacaccatcttcaacgtgggcag

Genotator setup To start genotator, enter genotator at the command-line. You will then be presented with the main genotator analysis window.

First, press the PRESS HERE TO SELECT button to browse to your fasta format sequence file. Select the organism from which your sequence originates, the select the analyses you wish to have performed [1] (green means include).

For the output option, make sure to select Current directory, as you will not have write privileges to the default selection and Genotator will fail.

Finally, press the Start annotation button to begin the analysis- you will be presented with a notice about the run - press OK to start.

Depending on current load on the server, the analyses may take a few minutes. Once it has completed, the genotator will disappear and you will be returned to the command prompt and a message informing you on how to view your results.

Browsing your results

To browse your results, enter genotator-browser my_sequence.tfa, replacing my_sequence.tfa with whatever was indicated by Genotator's closing message. You do not have to type in the full paths.

Genotator browser A colorful window summarizing the results of the various analyses performed will appear. You can click on the color bars to get details on particular results, and in some cases double-click to view details from the originating output files.

It is beyond the scope of this HOWTO to describe completely the usage of the genotator-browser, so please consult the official documentation for further elaboration.

To quit, select Quit from the File menu.



Notes on the programs used by Genotator

As of 2002-11-06, the Grail component does not work as the Grail server is not available.

Promoter prediction is provided by fa2TDNNpred. tRNA scanning is performed by tRNAscan-SE.

Homology searches are the result of blastx performed against the indicated databses. Please note that the installed databases may not be current at a given time.