HOWTOs
This is the HOWTOs collection.
*nix HOWTOs
Do basic tasks in Debian
This is a work-in-progress. Please check back periodically for additions to this guide. Feel free to suggest topics to be covered.
This is a very basic introduction to Debian, primarily geared towards those who are running Debian-sparc on their Sun workstation.
General Notes
- sudo
sudo has been setup on the machines so that you have full root capability, without knowing the root password*. When prompted for a password upon running a sudo command, it is your password that you should enter. It will retain the password for five minutes -- after that, you have to re-enter your password to do another sudo command.
*NOTE: Of course, you can simply change the root password on your particular box to something else, but for our sake (ease of administration), please don't. We encourage you to use sudo instead.
- firewall
There is a firewall setup on each machine allowing only ssh access. Reconfiguring the firewall (iptables) is beyond the scope of this document. Please open a helpdesk ticket for assistance with firewall-related issues.
Adding a user
sudo useradd -m username
The "-m" argument creates a home directory for the user.
sudo passwd username
By default, new user accounts are non-functioning until you set the password -- later, the user can go in and change it to their liking.
Updating the system
sudo apt-get update && apt-get upgrade
The "update" part tells Debian to fetch header information on newly available packages, while the "upgrade" part tells Debian to actually attempt the upgrade to these new packages. Usually, but not always, you will be prompted to verify that you wish to perform the upgrade.
Installing applications
sudo apt-get update && apt-get install package1 package2 ...
"package1 package2 ..." etc are the names of the package(s) you wish to install. Example: sudo apt-get update && apt-get install mysql
bash tricks
Connections HOWTOs
Connecting to a DAV Service
What is DAV?
DAV (pronounced as in davenport) is a way to provide file transfers via HTTP. In many respects, it can substitute for traditional FTP servers but provides a more robust, flexible, and secure way of sharing files.
Furthermore, most recent operating systems have built-in functionality that allows you to "mount" a DAV share just as you would a local network volume, so you can simply drag & drop files as well as access them directly without necessarily "downloading" them first or using a separate program.
For more information on DAV, please visit webdav.org.
Connecting
MacOS :: Windows 2000/XP :: Windows NT/95/98/ME :: Others
One small disadvantage of DAV-based file sharing is that the details of the connection method varies from operating system to operating system. Please see the particulars for your operating system of interest from the list above.
Another inconvenience concerns the use of "self-signed" security certificates. DAV clients will generally issue a warning that our certificate isn't from a "trusted" authority and require you to accept it despite this. Most clients also provide a means to accept our certificate permanently, in which case you will only have to do this once. However, the Windows certificate managment interface does not appear to do this properly and you will have to accept the warning each time you connect (and possibly multiple times per connection). Unfortunately, we know of no solution at this time.
Please have the following information (which should've been provided to you) before continuing: the URL you will use to connect to the DAV share, the login name, and the password.
MacOS
MacOS prior to MacOS X 10.4 (Tiger) do not have built-in support for SSL-encrypted DAV access. Please download and install Goliath and read its documentation.
For MacOS X 10.4 and higher, simply select Connect to server from the Finder's Go menu and enter DAV URL.
Windows 2000/XP
Windows 2000 and XP have built-in DAV support. For Windows 2000, make sure that you have upgraded to at least Service Pack 3- prior versions had known bugs. To make a connection, open the My Network Places icon on your desktop and then double-click the Add Network Place option.
On some installations/configurations of XP, you may not see My Network Places on the desktop- instead, please check your Start menu. You will have to select Next to proceed past the opening description, followed by Choose another network location when asked where your network place is.
In the subsequent dialog, enter the URL you were given and press Next. At this point you will probably be given a certificate warning- accept it. You should then be prompted with a login dialog - enter your login name and password and then Finish the wizard.
Your My Network Places window should now have an icon for the DAV share and it should open if your connection was successful. That icon should persist so for future connections, simply open it and login as usual.
You may be repeatedly asked to accept a certficate warning, or asked to login again despite having already done so. Just repeat as necessary. For details on how you can permanently avoid these warnings, see the HOWTO on installing 3rd-party certificates.
Windows NT/95/98/ME
The base Windows NT/95 operating systems did not natively support DAV. However, depending on the service pack level, Internet Explorer version, and/or Microsoft Office version, DAV support may have been added to your computer. If, when you open My Computer, you see a folder named Web Folders ("Web Folders" is what Microsoft calls DAV shares), this capability has been installed.
Windows 98/ME should have this capability installed by default.
To connect, open the Web Folders folder, then launch the Add New wizard. Enter the URL when prompted, accept any security certificate warnings, and then login with your provided login name and password. An icon for the DAV share should appear in that folder and persist for future connections.
Other operating systems
Please consult the webdav.org projects page for a listing of clients for a variety of platforms.
As a fallback option, it is also possible to use a standard web browser to access a DAV share, since it runs over HTTP. Just point your browser at the proper URL and login as usual. This method, however, will not let you download more than one file at a time, and provides no way to upload files, so is not recommended.
How To Install Microsoft UAMs for Macintosh
Step 1: Open the network browser
In the Apple Menu, click on the Network Browser.
Step 2: Locate HGSERV2 on the AppleTalk Network
After the Network Browser has loaded, look for the AppleTalk icon. Click on the arrow to the left of the AppleTalk icon to expand the AppleTalk Network.
Next, click on the arrow on the left side of the Gonda_HG icon to expand the Gonda_HG network
Now, locate the HGSERV2 icon and double-click on it.
Step 3:Choose Your Log On Method
A window may appear that will ask you which type of "log on method" you would like to use. If Microsoft Authentication is displayed as an option (or Microsoft UAM), then Microsoft UAMs are installed, and you need not continue. Otherwise, click on Apple Standard UAMs, and then click OK.
In the next window that appears, select Guest so you don't need to type in any password.
Step 4: Open the Microsoft UAM Volume Folder
A list of names (like in the picture shown below) will appear after you have successfully logged into HGSERV2. Find the icon labelled Microsoft UAM Volume and double-click on it.
Step 5: Locate Your AppleShare Folder
Set the open window from the last step aside for now--we will need it later. Now open the AppleShare folder on your computer. To do this, first double click on the Macintosh HD icon on your desktop. This is your hard drive.
In the window that appears, find the System Folder and double-click on it.
Step 6: Copy the AppleShare Folder
Now, you have to copy the AppleShare folder from the network to your computer--that is, you will copy the AppleShare folder found in Step 4 to the system folder found in Step 5. If you receive a warning when attempting to copy, read below. If you receive no warning messages, proceed to Step 7.
You might receive a warning (like the one below) when trying to copy. If so, click Cancel. Otherwise, if you do not receive this warning, please continue to Step 7.
To get around this warning, double-click on the AppleShare Folder in the System Folder window from Step 5.
In the Microsoft UAM Volume window from Step 4, double-click on the AppleShare Folder.
Copy the MS UAM icon to the AppleShare Folder on your hard drive.
Step 7: Reboot Your Computer
Congratulations! You're done installing Microsoft UAMs. All that is needed now is for you to restart your computer. You are now ready to use Microsoft UAMs!
How to Set Up Your Personal Drive on a Macintosh
General
Information
Before you set up your
personal drive, please e-mail computersupport@mednet.ucla.edu,
or stop by our office to inform the Computer Support team. A
quick initial setup must be completed before you will be able to
access your personal drive from a Macintosh.
We highly recommend that
you use Microsoft UAMs (User Authentication Modules) when
connecting to your personal drive from a Macintosh. This will insure
the highest level of security when transmitting your password over
the Gonda network. If you do not have this installed, please visit
the How
To Install Microsoft UAMs for Macintosh page.
Step
1: Open the network browser
In the Apple Menu, click
on the Network Browser.
Step
2: Locate HGSERV2 on the AppleTalk Network
After the Network Browser
has loaded, look for the AppleTalk icon. Click on the arrow
to the left of the AppleTalk icon to expand the AppleTalk Network.
Next, click on the arrow
on the left side of the Gonda_HG icon to expand the Gonda_HG
network
Now, locate the HGSERV2
icon and double-click on it.
Step
3:Choose Your Log On Method
A window will appear
that will ask you which type of log on method you would
like to use. We highly recommend using Microsoft Authentication
(also called Microsoft UAMs). If you do not see an option for
Microsoft Authentication, click
here for a guide on how to install Microsoft UAMs.
Continue to Step 4a after the Microsoft UAM has been installed. If you insist in using Apple Authentication (which transfers your password in unencrypted, continue to Step 4b.
Step
4a: Logging in with Microsoft Authentication
Click on Microsoft Authentication
and then click OK.
In the next window that
appears, enter your Gonda user name and password and
click OK. The Gonda user name and password is the name and
password you would type if you were logging into a Windows computer
on the Gonda network.
Step
4b: Logging in Using Apple Standard UAMs
Click on Apple Standard
UAMs and then click OK.
In the next window that
appears, enter your Gonda user name and password and
click OK. The Gonda user name and password is the name and
password you would type if you were logging into a Windows computer
on the Gonda network.
Step
5: Create a Desktop Shortcut
A list of names (like
in the picture shown below) will appear after you have successfully
logged into HGSERV2. Find your username, then drag and drop it onto
your desktop. This will create a convienent shortcut from which
you can access your personal drive.
You're
Done!:
Congratulations! You
can now use the icon you've just created to access your personal
drive whenever you want. Follow this same procedure on another Macintosh
to access your user space.
How to access Gonda servers remotely?
Titan titan.genetics.ucla.edu is our Windows 2003 based terminal server to enable remote access to Gonda servers. To determine if Titan is right for you, please read on. If you know for sure Titan is what you need, you may jump to this setup how-to -
Setting up Remote Desktop Connection for Titan
Where to use Titan
Titan is useful for remote connections within or away from Gonda, such as:
- Work from home
- Work from another office/building
- When your office computer doesn't have the application that Titan has installed
So your use isn't just limited to being "away from Gonda"
Advantage
Titan is useful for those who work from home but need files or applications on the Gonda servers-
1. Accessing your Mednet email personal folder (.pst) while not at Gonda.
2. Accessing your Windows home directory (M drive) etc while not at Gonda.
3. Moving files from your M drive etc onto local machine (i.e. moving a file saved on the Gonda file server to C drive of your home computer)
4. Generating .pdf files (server has the Adobe writer installed)
5. Running programs that are available at Gonda but not available elsewhere. (i.e. Licensed programs that are not installed at home or lab computer but a license is purchased for Titan i.e. Photoshop, Endnote etc) Check out our list of software installed on Titan below.
Disadvantage
Titan mimics your access in front of a computer and your experience will depend on the speed of your computer and Internet connection. The following are things that would affect you adversely.
1. If you have a dial-up connection, you will notice extended latency; graphics being refreshed slower.
2. If you have an unreliable connection, your connection to Titan may also be interrupted.
3. You will also notice extended latency working with programs that are graphically intensive.
4. If the server is extremely busy, your application's performance will also be taxed, as the server is being shared by other remote users. However, this server is powerful enough for our current demand that you should not notice a significant change.
Setting up Titan
If you're ready to set it up on your computer, please go to: Setting up Remote Desktop Connection for Titan.
Sample List of Software on Titan
-7-Zip
-ActivePerl 5.8.6
-Adobe Acrobat 7
-Adobe Photoshop Elements 3.0
-Adobe Reader 8
-AxioVision LE
-Citrix Program Neighborhood
-Compaq Fortran 6.5
-D-7000HSM
-Endnote 5
-Firefox
-Financial Projection Module (FPM)
-Genoseq ODBC setup
-Ghostview, Ghostscript
-GoDiagram Win 2.2
-Gregor
-HostExplorer (OASIS, AIS access)
-HP 3500 laserjet printer driver only
-Intel Fortran Compiler 8.1, 9.0, 10.0, 10.1
-Linkbase, with PDOX file
-MendelPro
-MikTex 2.7
-MicroSpell
-MS Office 2003 Suite
-MS Visual Studio .NET
-MS Visual Studio .NET 2003
-MS Visual Studio 2005
-MW Snap 3
-MyGeneration
-NDoc 1.3
-NX Client for Windows (nomachines)
-PCTex 5
-PDFCreator
-PDFill
-Progeny 6
-Python 2.5, 2.6
-QDB files (c:\qdb)
-QDB ODBC setup
-Quicktime
-R 2.1.1
-Sequencher Demo
-Shockwave player
-SPSS 12.0
-SQL Enterprise Manager
-SSH Client 3.2
-TeXnic Center
-TortoiseCVS
-Wavemaker 4.1
-WholePathwayScope
-Wink
-WinRAR
-WinSCP3
-WinZip
-Xwin 32
- More upon request
Mapping Network Shares Permanently on a Windows Client
To map a network share permanently on you computer, right click on the "My Computer" icon and select "Map Network Drive" from the drop down menu.
Now you need to select the letter that will be used to represent this share. You want to pick a letter that is not already in use. A safe bet would be to pick letters towards the end of the alphabet. Make sure to check "Reconnect at logon" so that you never have to map the drive again on this system.
Now, click finish and you are done
NX connections to Calypso
What is NX/Nomachines?
NX (or nomachines) is a type of connection method that allows a graphical login to calypso, our Linux-based cluster head node. Calypso has NX server software on it and you use a special NX client on your workstation (available from nomachine.com. The end result is something similar to X11-over-ssh but easier to use and much quicker. It's more like using remote desktop to Titan.
This document covers how to configure the NX client as a user of calypso. It does not cover how to install NX client- please contact us for assistance with installing the software.
You will also need a calypso key file - please contact us for this when you have the client installed. It should be named calypso.key.
Configuration
Configuration needs to be done once- once you have configured it, you will not need to do so again for your user account on the particular machine you configure.
To run NX client for the first time, look for it in your Start->Programs menu. You will be greeted by this wizard screen. It's not very informative, but Windows applications seem to like to reassure users about things. Just click the Next button, as everyone has been trained to do by such things.
The next screen asks you what the session parameters are. The session name is just a name you will use for this series of settings - just put calypso. The hostname is a bit more important: is should be exactly calypso.genetics.ucla.edu. The internet connection setting can be left at the default if you are configuring within the department. If you are setting up a system to connect to calypso from home, you may want to drop it down to IDSL or Modem.
Despite what this screen may lead you to believe, you're not really done yet. Click the Finish and ponder the inappropriateness of that label.
This is the login screen, but you are not ready yet to login. Instead, you need to do some more configuration, so click the Configure button.
OK, so things look a lot more complicated now. So much for the wizard. The first thing you might want to do is change the desktop type next to Unix to GNOME from the default (which should be KDE. You don't have to, but GNOME is something more users are familiar with.
Next, click on the Key button to configure the login key (which you should have on hand somewhere).
Here, you need to click the Import button and navigate to the key file you were given (ie calypso.key). Once you have done so, and loaded it, click the Save.
OK, now you're done. Click OK until you are back to the login screen and enter your calypso username and password before clicking the Login button. After a short wait, you should be logged into calypso's graphical environment.
If it's the first time connecting and you get an error, please try quitting the NX client and restarting it (sometimes it needs a little shaking). If you continue to have trouble, please contact us via the helpdesk and provide the text of the error log that appears under Details.
Secure X11 Connections
You can make a graphical connection to calypso using what is called "X11". With it, you can run programs that have a graphical interface (such as Gregor for Unix) and manage your files via a more friendly graphical interface than the standard Unix command line.
However, the setup of such a connection is a little bit more involved that your standard ssh connection.
Configuring X-Win
First, you need a program called X-Win32, which provides the actual graphical display. If you don't already have it installed, please see contact the helpdesk for assistance.
Once it's been installed, first run the configuration program, usually found in Start->Programs->X-Win32->X-Config. Click on the Add button to configure a session.
In the subsequent dialog, you'll be asked what connection type you would like to use. Select the XDMCP option, and then click the Next button.
In the next dialog, enter calypso for the Session name, select Broadcast for the XDMCP type, set the Window mode to Single, and check the Launch New Window option. Once you're done, hit the Save button.
Now, go Window tab, and select Single for Window Mode. Click OK when you are done to complete the X-Win32 configuration.
Now, you can run X-Win32. Nothing will happen yet- the X-Win32 icon will appear in your system tray and you may see a blank gray screen that you can hide for now.
Connecting and tunneling with ssh
To actually make the connection to calypso, you will need to ssh to it first. For this, you will need "SSH Secure Shell". This is installed on most computers in our department. If you can't find it under your Programs menu, then contact the helpdesk for assistance.
If you haven't already configured a "profile" for calypso, select Add Profile..." from the Profiles drop down menu, then give it a name (ie "calypso"). Once the profile has been created, you can go to the Edit Profiles option.
The profile editor may look different, depending on your version of SSH Secure Shell. Make sure you select the "calypso" profile you created above. The important configuration option is the hostname, which should be "calypso.genetics.ucla.edu". The username is convenient but not necessary.
The other important option is called "X11 Tunneling", and in this version of SSH Secure Shell appears in the Tunneling tab. Check the box to turn it on.
Once you have set these options (hostname and X11 tunneling), you can save by clicking OK. Now you are ready to connect. Select calypso from the Profiles drop down menu and you'll be asked for your calypso password. Once you've succesfully logged in, enter the following command to begin your X11 session:
gnome-session
Once your session has begun, you can hide the SSH Secure Shell window.
Setting up Remote Desktop Connection for Titan
There are 2 parts to connecting to Titan:
a. (one-time) Request to have Gonda account enabled for Titan access, and get "pcf" file
b. (recurring) login setup
a. Request to have Gonda account enabled
****Before logging onto Titan for the first time, please enable your Gonda account with Titan access with the IT office via the Helpdesk **** you'll also receive a "pcf" file that's needed for the setup.
b. Login Setup
If you have Windows XP or newer, you may skip ahead to step 2 of Login Setup.
If you're running Windows 2000 or older: You need to first download the Remote Desktop Connection client from Microsoft for free.
Windows:
Windows XP Remote Desktop Connection software
Macintosh: Please read the system requirements before proceeding
Microsoft RDC Client for Mac 2.0.1
b. Login Setup - step 1
After downloading, double click on the file (with file extension .exe for Windows, .dmg for Mac) to begin installation.
On the PC, after the installation, you can find the program under Programs; Accessories; Communications or alternatively Programs; Accessories; Remote Desktop Connection.
On the MAC, copy the Remote Desktop Connection folder onto your Macintosh HD. Afterwhich you may move the .dmg file along with the expanded folder into the trash, leaving only the copy on the HD active.
c. Login Setup - step 2
The following steps apply to both PC & MAC--
Opening the installed program (Remote Desktop Connection) yields this dialog box where you should type in titan.genetics.ucla.edu:33389
REPEAT ONLY THIS STEP for future logins.
If you like to set up Outlook, please try this link: Outlook Setup
Optional Fine Tuning
If you like to fine tune your connection, you may perform the following steps-
DISPLAY: Tune the desktop size to best reflect your local monitor size and/or how you like the terminal screen to appear. You may set it to full screen to fully mimic working at the server, or set it the size of a typical window so you can go back and forth on the server and local desktop.
LOCAL RESOURCES: If you like to move files back and forth between the server (i.e. M drive) and your own computer, you may want to map your drives. By clicking on "Disk Drives", all of your own computer's disk drives will be listed as additional network drives in the Windows Explorer on Titan, denoted as "C on COMPUTERNAME" etc.
EXPERIENCE: You may also reduce bandwidth by minimizing unnecessary traffic by unchecking all the boxes in the Experience tab.
Setup secure X11 connections using cygwin
Thanks to: http://x.cygwin.com/docs/ug/setup-cygwin-x-installing.html (that URL includes a few pictures, in case something is unclear)
GOAL To setup cygwin on a Windows workstation so that you can forward X11 apps from a Unix workstation.
ALTERNATIVES There are no other free and opensource alternatives to cygwin for X11 forwarding to Windows workstations. You can use commercial products such as Hummingbird eXceed, X-Win, or NX.
INSTALL cygwin
Now you've finished downloading and installing cygwin.
USE cygwin
In subsequent sessions, you only need follow the steps under USE cygwin.
Transferring files with ssh.com Secure Shell
In addition to its primary function as an ssh terminal (ie command line) program, ssh.com's Secure Shell also provides built-in file transfer features that allow you to move files to and from our Unix-based servers. The following describes how to do so. However, please note that installation and configuration of the software is presumed and not covered here. If you haven't already installed and configured the software, please see our other HOWTO for details first.
There are two ways to begin a file transfer, depending on whether you are already connected to the server in question via terminal, or whether you are only doing a file transfer.
Starting a transfer during a terminal session
If you are already logged into the server, simply go to the Window menu and select New File Transfer.
A new window will appear with two panes. The left pane represents your local file system and the right pane represents the remote side (the server).
Starting a transfer outside of a terminal session
You can also transfer files without having to initiate a terminal connection at all by launching the the file transfer program directly. Typically, this is found under Start->Programs->SSH Secure Shell->Secure File Transfer Client.
Once you've launched the file transfer client, you will need to connect to the server. Go to the Profiles submenu and select the profile for the setting to which you wish to connect (see our HOWTO on setting up ssh.com Secure Shell for details).
Once you've connected, you will be presented with a two pane window as described above: the left pane is your local file system and the right pane is the server.
Transferring files
There are a few ways to transfer files. If you navigate the filesystems using the panes, you can right-click on a file and select Upload or Download from the context menu, depending on whether you are right-clicking in the local pane or the remote pane.
When using this method, please be mindful of the location of the target pane, otherwise, you may have difficulty finding your file.
Another way to transfer files is to drag-and-drop it. If you drag a file from the server pane to your Windows desktop or another folder, it'll transfer it to that location. Conversely, you can drag Windows files to the server pane to upload.
The pane at the bottom of the window displays a list of the files you have transferred during your session. This is useful for checking on the status of an ongoing transfer and also for keeping track of what you have already transferred.
Using CuteFTP for FTP/SSL connections
In order to manage content on the Biostatistics website, you will need to use an FTP/SSL connection to the webserver in order to transfer files back and forth. For this, you will need an FTP client that has SSL (encryption) features - CuteFTP is one that is licensed by UCLA and available from the BOL Software page.
You will also need an account on the web server. Please contact the helpdesk if you need one.
Using CuteFTP
When you start CuteFTP, cancel any "Use Wizard" or "Setup Connection" dialogs. From the main screen, click on the downward pointing arrow to the right of the flower document as shown here:
From the menu that appears, select FTP/SSL Site
In the connection dialog box that appears, fill out all relevant info (label, host address, username, and password) as indicated here:
Once it has been filled out, click the Connect button. You'll then be presented with a view of the web server's contents in the right side pane. You can drag files back and forth between the left side (which represents your own computer) and the right side as appropriate.
On subsequent uses of CuteFTP, you can select this "profile" via the Connection Manager that opens at launch.
Using Putty for SSH connections
PuTTY is a free ssh client that can be used to connect to our Linux servers. You can read about PuTTY at http://www.chiark.greenend.org.uk/~sgtatham/putty/, or jump directly to the download page (there are many files listed - you only need putty.exe).
Once you've downloaded putty.exe, you are ready to run it. There is no installer, just the single file executable, so it can be placed anywhere you'd like (the desktop is a convenient place for most). Simple double-click on the putty.exe icon to get started.
Configuring a session
When you first launch PuTTY, you'll be presented with session configuration options. Here you can can create new sessions and select from existing ones. To create a new session, enter the hostname as indicated, the select SSH for the protocol.
To save this session, next enter a name for it in the Saved Sessions box, then click the adjoining Save button. Your session will now appear in the session list.
Finally, to actually start your session, double-click on the session in the list, or select it and click the Open button at the bottom of the window.
In subsequent uses, you will not have to enter the hostname and select the protocol, only the first time when you create the session.
The first time that you connect to a server, PuTTY will present a warning about the server host key - this is normal behavior. Simply click Yes to accept the key and you won't be presented with the warning when you connect to that server again.
Finally, you will be presented with the actually ssh session window and asked for your login/username and password.
A related HOWTO on using WinSCP to transfer files is also available.
Using Tortoise CVS for Revision Control
TortoiseCVS is a free CVS client for Windows- it speaks the CVS standard for revision control of files (typically program source code). It can work with a local "repository" (where your files and information about revisions are kept), or as described in this document, access files kept on a Unix-based server over an ssh connection.
If you plan to make frequent use of CVS against an ssh server, please make sure to investigated the advanced ssh instructions to avoid having to enter your passwords for every CVS transaction.
Getting Started
First, download TortoiseCVS at http://tortoisecvs.sourceforge.net/. Run the downloaded installer to install TortoiseCVS on your system (administrative privileges may be required).
TortoiseCVS doesn't function as a separate program, per se. Instead, it acts primarily as an extension to the Windows file manager and provides context-sensitive actions that can be accessed via right-click access. For example, if you right-click on the desktop after installing TortoiseCVS, you should see two new entries: one called CVS Checkout and one called submenu called CVS. Preferences for TortoiseCVS can be accessed from this CVS submenu, but the defaults work fine for most purposes.
Creating a CVS repository
Before you begin using CVS to manage your files, you need to know where your repository will reside and initialize it for CVS use. This can be on your local computer, or in our case, somewhere on the Linux server. A convenient place is a directory named "CVS" in your home directory. Thus, first log into your Linux account and create a directory named CVS by executing CVSROOT=/home/jbruin/CVS cvs init (users of csh/tcsh will have to alter this syntax).
The above only needs to be done once for the repository and each repository can contain as many projects as you desire, so typically, it will only have to be done once ever.
Defining and new module
You are now ready to import files into CVS. Typically, these files will reside in a directory on your Windows workstation and in CVS parlance will be called a module. Right-click on this directory and under the CVS submenu, select Make New Module...
You'll then be presented with a complicated dialog requesting details for where and how to store your files. Fill in as follows:
- Protocol: select Secure shell (:ext:)
- Server: enter calypso.genetics.ucla.edu, or the appropriate address of the Linux server
- Repository folder: enter /home/jbruin/CVS, or the appropriate full path to your repository.
- User name: enter your username for that server
- myprogram: enter a name for this module. Typically, this would be the name of your program. Generally, it is advisable to exclude spaces and punctuation marks in your module name.
Once everything is set, click the OK button. Note that you need to enter this information only once per module; subsequently, you can select the module details from the menu that appears at the top of this window.
If everything has been entered correctly, you should see a log window appear and then a password dialog. Enter your password (it may request it more than once). Eventually, you should see a success message - your new module has been created.
Adding files to your module
Next, you need to import all your files into the module (the step above just prepared the module). Right-click on the directory again and this time select CVS Add Content.... You may notice that the icon for this directory now appears different, probably with a green mesh overlay - this is the indicator that this directory is under CVS control. Once you've selected CVS Add Content..., you be presented with a dialog listing all of the files in that directory. Go through this list carefully and uncheck any files that do not need to be revision controlled. Typically, only source files need revision control - compiled binaries, temp files, object files, almost all binary format files shouldn't be placed in CVS. Take care to do this during the importing step as removing files later is troublesome and will continue to take up space in your repository (since it is a permanent history of your module's files).
Once you've properly marked the files you want to import, click OK. Again, you will be asked for your password, possibly many times (once each for each subdirectory). Enter it as often as it asks. Eventually, you should see a success message.
Commiting your first version
Now that CVS knows about your files, you must commit. Commiting is CVS's way of "saving" changes and actions, so until you perform a commit, nothing has been "saved". In our case, we've told CVS that we have a bunch of files for this module, and now we have to tell it to make those additions permanent. To do so, again right-click on the directory with your files and this time select CVS Commit.... This will look similar to the file addition dialog above, but there will be an additional box where you should type in a comment describing what you are committing. Here, we are simply importing all files, so the comment can be "Importing". When you later subsequently commit changes to files, you should describe in more detail what changed between commits.
Basic Usage
After making the initial commit, your project and all the specified files are now under CVS management. For the most part, this is not something you have to give much thought to as you work with your files. However, there are two actions you should keep in mind: updates and commits.
A CVS update attempts to sync your local directory with that in the repository and report any changes. Typically, you will see 3 classes of files when you do a update:
- Files that match between your local copy and the repository (ie no changes have occurred)
- Files that you have changed but not yet commited - these will appear with a flag M and will not be uploaded to the repository until you do a commit
- Files that have changed in the repository but your local copy is out of date. This will occur, for example, if two or more developers are working with the same repository and another developer has commited some changes since the last time you did an update. In this case, these files (marked U) will be downloaded to your local copy of the module. This will also occur if you are missing a file from the repository (for example if you deleted one by mistake, or if another developer added one).
Another, less common, occurrence is a combination: you have modified your local copy of a file and another developer has committed changes. In this case, CVS will try to reconcile both sets of differences and will warn you of the circumstances. Typically, it will mark areas of the file in question where conflict arises and you must reconcile them in some way.
One other action that will frequently arise is the addition of a file. Simply creating a new file in your local copy of the module is not sufficient to make it part of CVS management: you must add it (right-click and select CVS Add) and then commit it as usual. Conversely, don't just delete a file from your local copy to remove it- when you next execute an update, it will re-appear. Instead, right-click and select Remove from the CVS submenu.
Advanced SSH configuration
During large updates and commits, you may find yourself having to enter your password quite often, depending on how the number of subdirectories in your CVS module. With a little work, you can set up ssh to only require you enter your password once per session by using ssh's key-based authentication.
First, you will need a couple of additional ssh tools. Visit the PuTTY home page and download the following 3 programs:
Creating your keys
Place these 3 executables in a directory somewhere (for example C:\putty). Run puttygen first. Select the SSH2 RSA option at the bottom of the screen, then click the Generate button. This will take a while, and you'll be asked to move your mouse around. Once this is done, enter a passphrase twice, where indicated. This should be different from your password, and should be a sentence. For example My username on calypso is jbruin (Do not use this, or a variant, as your passphrase!).
Now save your key by clicking the Save private key button and storing this in a safe place (for example, in My Documents). Remember where you saved this file. If you lose it, you'll have to go through this again.
Next, copy the contents of the text box near the top, the one that looks like gibberish, into your clipboard. You will need to create a file in your Unix home directory at ~/.ssh/authorized_keys2 with this as its contents. Make sure that the directory and file have restricted permissions by executing chmod 700 ~/.ssh and chmod 600 ~/.ssh/authorized_keys2.
Finally, configure putty to mimic the TortoiseCVS connection to the CVS server. Run putty and in the configuration, select SSH for the protocol, enter your hostname (ie calypso.genetics.ucla.edu), enter a session name, and save your settings.
Using your keys
Now, run pageant, which is the authentication agent that will manage your keys. After double-clicking on pageant, it will appear in your Windows system try (usually on the right side of your task bar). Right click on it and select Add Key. You'll then be asked to locate your private key file and enter your passphrase.
If everything has been configured correctly, you should be able to perform CVS actions without having to enter your password each time. Instead, pageant will manage the connections and provide the authentication credentials for the keys you created.
Using WinSCP for File Transfer
What is SCP? Why should I use it?
scp is a file transfer protocol not unlike FTP - it is a means to transfer files between client machines and Unix-based servers.
The difference is that scp is secure. The ftp protocol uses cleartext passwords than can be sniffed/intercept by malicious individuals. These passwords can then be used to compromise your account. scp, on the other hand, encrypts all data transfers so passwords cannot be intercepted.
Obtaining WinSCP
Using scp is quite easy, but as it is a separate communications protocol from ftp, you will need to obtain a new client program that can speak it. WinSCP is one such program that is as easy to use as most ftp programs and is free. It can be obtained from http://winscp.sourceforge.net/eng/. Look for the download link for the exe version, and save it to your desktop or where you prefer to install programs.
Using WinSCP
When you first run WinSCP, you will be presented with the main login configuration screen. Here, you will need to enter the address of the server you wish to conect to and your username.
If you are using a computer that only you use, then you might want to enter a password as well. If you are using a shared computer, it would probably be best not to enter a password at this time (you will be asked later).
Once you have configured the host name and user fields, click the SSH tab at the left sidebar of the window.
In this tab, make one change to the WinSCP default settings: for Preferred SSH protocol version, select 2
If this is the first time connecting to this server, click the Stored sessions tab next so that you can save your settings.
Here you can save your settings so that you won't go through the above each time. Click the Save button and give the session an appropriate name (usually the default is OK).
When you run WinSCP again, you will be presented with this screen first, so you can simply select the particular settings you want to use for login. If you wish to configure a connection to a new server, select the Basic tab and repeat the steps above.
Once you have all your settings configure, you can click the Login button at the bottom of the window.
The first time you connect to a particular server, you will see a notice about host keys and trust. You can click the Yes button - you will only see this the first time you connect to a server.
If you didn't configure a password above, then you should be presented with a password prompt.
Once you have sucessfully logged in, you will be presented with a two-pane window that should be familiar. On the left is a representation of your local (Windows) computer's file system. On the right is the remote (Unix) file system.
To transfer files first make sure to browse to the proper destination in the appropriate pane. Then browse to the file(s) that you want to transfer in the source pane (you can use control-click to select multiple files). Then press the F5 Copy button at the bottom of the window. Alternatively, you can press the F5 key or drag-and-drop files to initiate transfers.
Using ssh.com Secure Shell for SSH Connection
Obtaining the SSH client:
You can obtain SSH by requesting it from the IT Office
or you can download SSH for your PC or Unix system at these locations:
http://charlotte.at.northwestern.edu/bef/SSHdist.html
http://www.sfsu.edu/~helpdesk/ssh/ssh329/
http://www.filewatcher.com/m/SSHSecureShellClient-3.2.9.exe.5517312.0.0.html
Installing SSH:
Double Click on the .exe file for the SSH Client
Note:
Version 3.2.9 is the one that we will be covering in this Howto. This is the last version of the Secure Shell software from ssh.com that is free to download and use. If you would like to purchase a newer version, you can go to http://www.ssh.com
After you double click the executable, the installation process will start. Go through the steps of the installation and select your desired choices. Soon, you will see a window indicating the installation has been completed.
Configuring SSH:
The last step is to configure SSH.
Run SSH, then go to profiles and click on Add Profiles
Next, type in the name you want to use for your new profile and
click on the Add to Profiles button.
Now, go to Profiles again and select Edit profiles this time. From the new window, select the profile name you just created. Make
sure to put in the host/server name (shown here for calypso.genetics.ucla.edu) and your user name. All other parameters should be set to
to what you see here. Then click OK.
Now go to Profiles yet again and select the server you just configured (calypso). Upon your first connection attempt, a window like the one below might pop up and ask you if you want to save the host key. Click Yes.
You should then be prompted to enter in your password in a window like the one below. Put in your password and click Ok.
If your password was correct, you will be brought to the command line of the shell connection. You are done!
Email HOWTOs
Changing Your MEDNET Email Password
This guide shows you how to change your MEDNET email login password, it's used when you voluntarily want to change the password, or when you're prompted that your old password has expired or about to expire.
Click here to learn more about the MEDNET email policy.
Shortcut to the NT Password Management Page
To change your MEDNET email password, please go to this link: https://www.mednet.ucla.edu/ChangePassword/. It'll bring you to the following page:
Fill in the Domain field with "MC" or "mewwex" or "ad" (depending on which domain you were given), as shown in the screenshot, and fill in the rest of the page.
Alternate Method
To change to your MEDNET email password, you'll need to go to the Web Outlook Access Client.
If you have never used the Web Outlook Access Client, you can first check out the setup howto.
Assuming you have successfully logged into your account, you will see the menu bar on the top of the browser window like the image up above.
Click the Options icon.
You will see a new navigation pane on your left. Scroll down the list of options until you see the Change Password option. Click on it and the middle pane will refresh and look like the picture above.
The domain and username is already filled in for you. Put in your old password and your new password in the appropriate boxes. Click the Save button at the top to finish the process.
Click the Log Off icon at the top menu to exit. Log in using the new password you chose to make sure everything worked out fine.
NOTE: This change of password affects your MEDNET email only, to change your Gonda login, check out the General Password Change howto.
How To Set Up Outlook for Mednet Email - for Off-Campus Use
In order to use Outlook away from campus, an extra piece of software called a Virtual Private Network (VPN) client is required on your computer.
1. VPN client installation: You may find detailed instructions on how to install the VPN client for your operating system here: http://vpn.mednet.ucla.edu/.
2. Then you will also need to get the Profile Configuration Files (pcf) from the Human Genetics IT Office.
Note: These pcf files expire every quarter, once you register with the IT Office, make sure you're on the VPN mailing list so you'll be given the latest copy every quarter.
The rest of the setup is EXACTLY the same as the on-campus setup, please refer to How to Set Up Outlook for Mednet Email - On Campus.
Alternate Option Without Using VPN
If installing a VPN program is not viable or not preferred, you may connect to our Windows Terminal Server - Titan. It offers a suite of office applications including Outlook for email. If you have a personal folder (.pst) attached to your Outlook, Titan will allow you to connect to it as well. (whereas you won't be able to do so with the VPN.
Here is a guide on how to connect to Gonda Servers using Titan
How To Set Up Outlook for Mednet Email, On Campus
Your version of Outlook maybe different, so the windows you see may not be exactly the same as shown here. However, the general steps and names will be will be the same.
1. Open the Control Panel from the Start Menu.
2. When that folder opens, double click on "Mail".
3. When the window opens, click on E-mail Accounts.
4. When the Account Settings window opens, under the E-mail tab, click on the New... button.
5. This is going to be a Microsoft Exchange account.
6. Choose to manually configure the server settings.
Again, this will be a Microsoft Exchange account.
7. Under Microsoft Exchange Server, type in "EMGMB1.ad.medctr.ucla.edu". Under user name, type in your user name (everything that comes before @mednet.ucla.edu) and click on the Check Name button.
8. A window might pop up asking you for your Mednet login credentials. Make sure to include "ad\" before your username.
9. You will be brought back to the original window like in Step 7, except this time both the Microsoft Exchange server and the user name should be underlined. The Microsoft Exchange server listed may have also changed in name. That is fine. Click on the Next button.
10. Your Mednet email account should now show up under the list of email accounts that Outlook has set up. If need be, set the Mednet account as your default account. To verify that your Mednet account is the default, look at which account is listed at the bottom, where it says "Selected email account delivers new email messages to the following location". Make sure that the name listed there is in the form of: "Mailbox - Lastname, Firstname\Inbox"
11. Now you're done!
Knowing Your MEDNET Email Policy
This guide oulines the basic policy differences between the 2 email domains, MEWWEX and AD
There're currently 2 main groups of email users, the previous group logging onto MEWWEX the newer members using the AD domain. Your account policies are different:
MEWWEX users
- No Password Expiration
- 0 - Number of Passwords Remembered (Password History)
- 3 - Number of invalid login attempts before your MEWWEX account is Locked
Account automatically unlocked after 15mins.
Default limit applying to MEWWEX users
The default mailbox limit on all accounts is 15MB (15,360KB). You will not be able to send email if you have exceeded your mailbox limit.
AD users
- 95 Days - Password Expiration
- 6 - Minimum Password Length
- 3 - Number of Passwords Remembered (Password History)
- 5 - Number of invalid login attempts before your AD account is Locked (you MUST call the Helpdesk at 310-794-Help to unlock it)
Default limit applying to AD users
- An automated warning message will be issued when your mailbox grows to 28MB.
- You will not be able to SEND any new messages when your mailbox exceeds 30MB, but you will continue to receive new messages.
- You will not be able to SEND and RECIEVE email if your mailbox grows to 300MB. Contact your local computer support
To change your MEDNET email password, please go to this link: https://www.mednet.ucla.edu/ChangePassword/. It'll bring you to the following page:
Fill in the Domain field with "MC" or "mewwex" or "ad" (depending on which domain you were given), as shown in the screenshot, and fill in the rest of the page.
NOTE: This change of password affects your MEDNET email only, to change your Gonda login and Calypso account, check out the General Password Change howto.
MEWWEX Email Migration
Details about MEWWEX Email migration
Users must exit from Outlook before mailbox migration
WHEN: December 11th from 7 pm until approx. 10pm
Your password will be reset to username06.
So for username jbruin, the password will be jbruin06.
Don't forget to change your password first thing tomorrow morning at:
https://www.mednet.ucla.edu/changepassword/
Logon Credentials Change:
All the examples below use jbruin as the username
If your email client has a logon window with 3 fields, use AD for the domain field. For example:
If your email client only has 2 logon fields, use AD\username for the username field. For example:
The same applies to the Outlook Web Access (OWA). It has only 2 fields on the logon window.
So you will use AD\jbruin for the username..
New Password Policy:
AD Domain Password Policy
95 Days - Password Expiration
6 – Minimum Password Length
3 – Number of Passwords Remembered (Password History)
5 – Number of invalid login attempts before your AD account is Locked permanently
User will receive an email warning that your AD password will expire in 1, 5, 10 or 15 days.
You can change your password at this site:
https://www.mednet.ucla.edu/changepassword
Mailbox Size Limits:
The default size of your mailbox will increase to 250 MB
An automated warning message will be issue when your mailbox grows to 225MB
You will not be able to SEND any new messages when your mailbox exceeds 250MB, but you will continue to receive new messages
You will not be able to SEND and RECEIVE email if your mailbox grows to 300MB. Contact the Enterprise IT Help Desk.
Outlook Web Access (OWA) 2000:
Users will now be able to use Exchange 2000 OWA which has better calendar functionality. The new address to access the OWA will be:
https://mail.mednet.ucla.edu/exchange:
When prompted for User Name, type your Domain\UserName (e.g. AD\JBruin). If your browser asks for User Name and Domain as separate fields, enter your UserName (jbruin) in the User Name field, and AD in the Domain field.
Tab to the Password field and type your password
For those currently using
www.genetics.ucla.edu/email to access the OWA, we will update the link after the migration to point to the new Exchange 2000 OWA.
Known/Potential Issues: for AD Password Email Expiration Notification:
* If your AD password has expired and you try to use OWA 2000, it will not warn you that your password has expired, and will keep prompting you for your password. Eventually, your AD account will probably be locked.
* Spell Checker feature is not available yet with OWA 2000 client
* Outlook Public Folders are not available yet with OWA 2000 client
* Don’t use OWA 2000 to reset your passwords
* MAC users using Entourage as their email client, their password locks after 1 bad password. The reason is that Entourage tries to resend the password more than 5 times. So it locks your account.
Making Mail Suck Less
Your mail sucks. The password is always getting locked. Your mailbox is always full. You have viruses and spam out the wazoo. Your "Personal Mail Folder" is always getting corrupted. And all of your outgoing mail is tagged with an obnoxious multi-line disclaimer of questionable legality and certain idiocy.
There really isn't a need to put up with all of this- there are better ways to handle mail.
The problem is Outlook (the program you run on your computer) and Exchange as run by Mednet. The solution: don't use Outlook and don't use Mednet.
The Server
First, the server part. You can get an email address from Bruin Online instead. BOL gives accounts to any UCLA student or staff, you just have to request one. The benefits to a BOL UCLA address are many fold:
- Shorter address (jbruin@ucla.edu instead of jbruin@mednet.ucla.edu)
- More space (BOL offers 50MB, Mednet 15MB)
- BOL provides spam tagging, making it easier to sort out junk mail
- BOL doesn't attach an obnoxious multi-line disclaimer of questionable legality and certain idiocy to your email
- BOL isn't violently hostile to non-Windows users.
- The satisfaction that comes from knowing you are not using a mail server from a criminally convicted monopolist.
There are, however, some downsides to switching from a Mednet address to a BOL one:
- You still have to receive mail from annoying Mednet accounts.
- The Microsoft Way means that some "integrated" features will no longer work (see note on calendars below).
The Client
While technically you can continue to use Outlook with a BOL email account (and benefit from all the pluses mentioned above), there really isn't a point to using Outlook if you are not chained to The Microsoft Way. BOL uses Internet standard protocols for communications, so pretty much any email client can be used - you actually now have a choice! This is how it used to be before Microsoft's business practices took the computing world hostage. Also, note that many of these products actually address shortcomings in Outlook, shortcomings Microsoft would never admit to (cf Internet Explorer and Firefox).
Benefits to using something other than Outlook:
- Threat of mail-attached virus infection reduced greatly.
- You can choose something you like
- Many have advanced spam controls
Downsides:
- You might have to spend 1 day getting used to a new interface. If you are unable to do this, then it is advised that you stop using the Internet as you represent a grave hazard to those around you (and by "around", we mean "EVERYWHERE"). Really, you spent some time learning Outlook at one point, what makes you think it's OK to have to stop learning ever again?
Since there are so many clients now available to you, this document cannot cover them all. MacOS X users are encouraged to use Apple's Mail.app. It's slick and its interface has the polish Apple users have come to expect. For Windows users, here are links to a few that we recommend:
- Thunderbird is the email client brought to you by the fine folks in the Mozilla group, makers of a fine browser called Firefox, which you may have heard of.
- Sylpheed Claws is a mail client with many features advanced users might appreciate.
Note: Eudora is not recommended. However, UCLA users do have access to a site-license, so if you'd prefer, you can use it. See! Isn't choice nice!
Calendar
One important note: Mednet's Exchange+Outlook combination provides a calendar feature. Some people like it. BOL doesn't provide such a feature. You can continue to use Outlook+Mednet for calendaring, even if you switch email providers/client. Microsoft would like you believe that email and calendaring are one and the same (they are not), and keep you tied to their product. Their success is largely due to perpetuating falsehoods like this and keeping their users ignorant of such details.
----------------------------------------------------------
IMPORTANT WARNING: This page (and any attachments) is only intended for the
use of the person or entity to which it is addressed, and may contain
information that is privileged and confidential. You, the recipient, are
obligated to maintain it in a safe, secure and confidential manner.
Unauthorized redisclosure or failure to maintain confidentiality may subject
you to federal and state penalties. If you are not the recipient, please
immediately notify us by return email, and delete this message from your
Intarweb.
----------------------------------------------------------
Setting up Outlook AutoArchive
Background
By default, Outlook will prompt to archive your email messages to a certain location. That location is NOT what we want to use, especially after setting up a personal folder on the M network drive (or other locations you preferred).
We need to reconfigure the default autoarchive settings so when it is done, it will redirect all old mail into your personal folder, instead of the place hidden deep in the system files within Windows, often forgotten as people upgrade or retire their computers.
Steps
1. Within Outlook, go to Tools, Options, the Other tab.
2. Click on AutoArchive button.
3. In the middle section, where it says "Move old items to:", hit Browse, and go to your M drive, then double click on the personal folder you have created, likely to resemble something like outlook_username.pst.
4. Confirm that it is indeed the location you want all old items to be moved to, and other options are to your likings. You can choose to have it run more often (1st option), and what are considered "old items" (clean out items older than...)
5. You can click on Apply these settings to all folders now, unless you know very well what you're using and would like to configure each folder individually (recommended for those who would like to finetune further)
6. OK all those windows and you're done.
Fine-tuning settings for each folder
This section is optional unless you know what you're doing and really need separate archive settings for each folder. Be careful you may also run the risk of mis-configuring something and lose mail. Triple-check before proceeding.
This is useful in situations e.g. if you rarely refer to your sent item folder but need more space for your Inbox: You can set the Sent Item folder to "clean items older than 3 weeks", while using "older than 6 weeks" in Inbox. Items in your Calendar usually won't take up as much space so it can be tuned to use "older than 1 year", etc.
1. Right clicking on each folder under the "Mailbox - your name" tree, clicking Properties and the AutoArchive tab gives you more fine-tuning power.
2. By default, the choice "Archive items in this folder using the default settings" would be chosen. It is the settings we just configured from the previous section.
3. Choose "Archive this folder using these settings:" if you want this folder to differ from the rest. Both retention and location can be changed individually.
Setting up Outlook personal folder (.pst file) on M drive
Background
Since there's a relatively limited amount of space available on the Mednet email server, the "personal folder" becomes the alternative to archive emails that are necessary for records but not actively referred to. At Human Genetics, we recommend storing such "personal folder", which is basically a file with a .pst extention), on the user's network drive, commonly known as the M drive.
When is the personal folder needed
It is needed when you have reached your quota after heavy use, and you have stored more items in the mailbox than allowed.
It is not intended for indiscriminate attachment storage. You should always groom your mailbox for unnecessary items first, especially attachments (both from Inbox and Sent Items).
All folders under "Mailbox - Your name" are still stored on the email server, so even if you move data from the Inbox to those subfolders, your quota-use stays the same. The next step is to create a personal folder where you can free up your quota by moving mail off the email server to the local drive, or as described in this how-to, the M network drive.
Steps
At this point, it is assumed that you have used your Mednet email account for a while and have accumulated more email than you can groomed away and have reached your quota mulitple times.
* The wording used in the following instructions may not be exact. Wording differs depending on the version of Outlook you're using, but the general name will be very similar.
1. While logged on in Outlook, go to Tools, Account Settings, and go to the Data Files tab
2. Click on the Add... button to add and configure a new Personal Folder File.
3. Choose the type of Outlook Data File you want. If you're using Outlook 2003, you will want to choose "Outlook 97-2002 Personal Folders File (.pst)" to get most compatibility with other systems, e.g. Titan etc.
4. A window will pop up prompting you to choose where to save the new file. Browse to your M: drive and navigate to whatever folder you want to save it in.
5. Put in a filename. We recommend it to include something about your username and the date or year. This makes it easier for you to distinguish older folders from newer ones. Click Ok.
6. Another window will pop up to ask you what you want to name the folder. Choose a meaningful name, this will be the one that shows up in your list of folders in the left navigation pane of Outlook. At this point, you are also given the option to create a password for this folder. Whether or not you implement this is your preference. Click Ok when you are done.
7. The new Personal Folders File you have created should now show up under the list of Data Files. Make sure it has been created by checking your M drive, the file named above should appear. Also, make sure that the Data File labeled "Mailbox - Lastname, Firstname" is still listed as the default. Click on the Close button and you should be all done!
Note: Microsoft Outlook imposes a roughly 2-gigabyte size restriction on any and all Personal Folders Files (.pst). However, some users have reported problems with accessing their folders even before reaching that limit (usually when they reach the 1.5 gigabyte threshold). To avoid this, keep an eye on the size growth of your pst files and create new ones as you see fit.
Another crucial step to reconfigure AutoArchive settings
After this, another crucial step is to reconfigure your AutoArchive settings within Outlook. By default, Outlook will prompt to archive your email messages to a certain location. That location is NOT what we want to use, especially after setting up the personal folder outlined above. Here is the HOW-TO on AutoArchive.
Using Web Outlook
Web Outlook is officially called Outlook Web Access, and is referred to as OWA in general and within this how-to.
This how-to is based on access via Microsoft Internet Explorer, screenshots and dialog boxes may be different with a different browser.
Pre-requisites
To connect, you will first need to have a compliant web browser, which has 128-bit encryption. Checking the Help section of your browser may reveal the encryption strength or cipher strength. If you see that you have 56-bit, your browser requires an upgrade. Please refer to the browser vendor for upgrade information.
PC users:
For those with Windows XP SP 1, you can download Internet Explorer 6
For those with Windows XP SP 2 or 3 (32 bit), you can download Internet Explorer 8
For those with Windows Vista, it may come prepackaged with Internet Explorer 7. You have the option to upgrade to Internet Explorer 8
If you have the 64-bit version of Vista, Internet Explorer 8 can be found here
If you have Windows 2000, you'll need the Windows 2000 High Encryption Pack.
Of course, you also have the option to go with a third-party, non-Microsoft web browser. Mozilla Firefox is a popular option.
Linux and Mac users:
The internet browsers that come prepackaged with those operating systems should be able to render the OWA. If not, you also have the option to go with Firefox or any web browser you wish.
Logging in
Address is https://mail.mednet.ucla.edu/exchange.
Or you may use our easier to remember shortcut - www.genetics.ucla.edu/email
On the front page of the OWA, type in your
User Name: mewwex\your username or AD\your username whichever was given to you (mewwex and AD are the older and newer domain names, respectively)
Password: password that was given to you upon account creation
Click Log On
This is how the main screen looks like upon login. Navigation bar on the left, menu on top (new message, delete, reply, etc). You may click on each sender's name to go into the specific message.
NOTE: It is recommended that you change your default password upon the initial logon. Here is the how-to on Changing your MEDNET Email Password.
If you're interested, Mednet also has an Animated Demo on how to access your web outlook.
Human Genetics Helpdesk
Welcome to the Human Genetics Helpdesk. Here you will find helpful documents, detailing how to accomplish many common tasks related to computing in Human Genetics. If you are unable to find an answer to your question or problem from among the documents below, you can also submit a helpdesk request here as well.
Computing Support
Frequently Asked Questions
How-tos for File Server Upgrade (hgserv2 -> Helix)
Misc
Connecting
Email
Bioinformatics
Miscellaneous HOWTOs
How Does the Nightly AutoUpdate Work?
Introduction
The nightly Automatic Software Update Services provided within the Human Genetics Department is aimed towards patching a large number of workstations and servers on the same day the patches are released.
Pre-requisites
In order to participate, you need to be running one of these systems:
Windows 2000-based servers and Windows 2003-based servers as well as desktop computers running Windows 2000 Professional or Windows XP Professional.
Your system will also have to have group policy configured so it will know where to pull the updates. Computers set up by the IT office will have this feature enabled.
Update Process
1. New updates/security patches are released by Microsoft.
2. The IT office approves the updates.
3. Workstations configured to use this service download the approved list of updates from our server and apply them.
4. If a reboot is necessary, the workstation reboots if no user is currently logged in. If a user is logged in, a message will come up asking the user to reboot the machine at his/her earliest convenience.
Update Time Window
The AutoUpdate runs nightly at 2:00am, 3:00am or 4:00am. Therefore, to ensure that your patches are installed properly and the system can reboot, you're advised to log off nightly, without shutting down your computer, so the process can complete.
If the computer cannot reboot, patches that require a reboot to activate will have no effects in the mean time.
How To Change Your Gonda Password
Background
There are mainly 2 passwords used at PC workstations at Human Genetics (more if you use Linux or Macintosh).
- Gonda (the one you use to log onto the computer)
- Mednet (the one for name@mednet.ucla.edu email).
They are DIFFERENT and changing one does not change the other.
If you're looking to change your Mednet password, you can go to this link.
Changing Your Gonda Login Password
After you have sucessfully logged onto the computer, press CONTROL-ALT-DELETE TOGETHER, you'll see the desktop disappears and a box appears. Click on the CHANGE PASSWORD button and fill out the various fields
If not already selected, the Log On To field should say GONDA.
That's it!
How To Use the Scanner
The scanner is located in room 5545 GC. You'll find it on your right-hand side as you walk in toward the back of the room. If the computer is currently logged-in, hit ctrl-alt-del to log out before doing any work.
1. After logging in, press the purple button on the front of the scanner. This will automatically launch the tool used to control the scanner. To the left is a picture of the initial screen. Hit the button labeled 'Preview' to start scanning.
2. After the preview finishes, use your mouse to draw a box around the area that you would like to scan. Also use the options on the right to select the properties for the image. Here are properties that I recommend:
*Resolution: 75 - 100dpi
*Color mode: Color for color images, grey scale for text.
Hit Scan when finished. This will import the image into the editor where it can be manipulated and saved.
3. Your image will now appear in the editor. You can use this simple image editor to do a number of tasks, including rotating, resizing and cropping the image. When you are done, save your image as TIF to your M: drive. That way you'll be able to safely import it into most other programs.
Installing a Printer (Windows 2000 or XP)
Background information (can be skipped)
Roaming profiles are not in use here within the Gonda network, therefore your printers and desktop contents are different depending on which workstation you log onto. If you "roam" around, meaning use multiple workstations, you'll need to set up a printer on each one that you use.
Installation
1. To call up the "Add Printer" screen:
On Windows 2000
Start
Settings
Printers or Printers and Faxes
Add Printers
On Windows XP
Start
Printers and Faxes
Add Printers
2. At the "Local or Network Printer" screen, choose
A network printer, or a printer attached to another computer.
Click
Next
3. At the "Specify a Printer" screen, choose the 2nd selection: Connect to this printer (or to browse for a printer) Select this option and click Next . You can leave the field blank and click Next
4. It may take a moment before a list of printers come up in the main box. When choices are shown, different level of detail may be listed. You'll need to scroll down to the GONDA level and expand it by double clicking on it. Then Scroll down until you find Helix and expand that too.
Microsoft Windows Network
GONDA
HELIX
then choose a printer listing that has a name corresponding to your office/lab room number.
(e.g.) If you're in the 6th fl. room 6111, this is your printer: \\HELIX\hg6111
5. Click Next when you have selected the correct printer. A window will pop up asking if you want to make this your default printer. Select your choice and click Next. Another window should pop up saying that the printer has been successfully added. Click Finish and the new printer you have added should now show up under your list of Printers and Faxes. You're done!
If you're still unsure or unable to connect to a nearby printer, please submit a help request at helpdesk.genetics.ucla.edu.
SSL Certificates for Human Genetics
We make use of encrypted connections (SSL) on many of our web services in Human Genetics. This is the same type of connection you see when doing shopping online- the url begins with https and your browser probably displays a little padlock icon.
Unfortunately, most browsers, by default, will not recognize the certificates we use for SSL and will generate warnings. In some cases, it'll warn you only once and and you can choose to accept it. In other cases (Internet Explorer in particular) you may be bombarded with many warnings without reprieve.
In any case, nothing bad will happen, but the warnings can get annoying. If you would like to eliminate these warning, you can add a certificate we use to your browser as follows:
- Internet Explorer
-
Visit https://www.cacert.org/index.php?id=17. You'll be asked to answer a series of prompts (5 or more). Answer yes to them.
- Safari/MacOSX
-
Download https://www.cacert.org/certs/root.crt. Once it has downloaded to your computer, double-click on it and the MacOS X Keychain application will open. Add the certficate to X509Anchors.
- Other browsers
- Visit https://www.cacert.org/certs/root.crt and answer "Yes" or "Accept" to prompts as appropriate.
Bioinformatics HOWTOs
Bioinformatics Software available on the Human Genetics cluster
The following lists bioinformatics software available on calypso. The list below does not provide the actual commands that you would type to access the software. For usage details, visit the software documentation links provided (where available), or contact us for support. You may also want to try executing
ls /usr/local/bin/
on calypso to see the actual commands available.
- Absoft Fortran compiler
- APM - Affected Pedigree Member method of linkage analysis
- ARB - various tools for sequence database handling and data analysis
- Artemis - genome viewer and annotation tool
- Aspex - affected sib-pair exclusion mapping
- Autoscan - script for automation of MAKEPED/DOWNFREQ/PEDCHECK/ANALYZE
- Blade - Bayesian LinkAge DisEquilibrium mapping
- NCBI Blast
- BLAT - BLAT on DNA is designed to quickly find sequences of 95% and greater similarity of length 40 bases or more.
- ClustalW - Multiple sequence alignment
- CRI-MAP - construction of multilocus linkage maps
- Diseq - Likelihood-based linkage disequilibrium analysis
- EMBOSS - software for sequence analysis
- fasta - sequence comparison
- FastEH+ - model-free analysis and permutation test(s) of allelic association based on EH
- FBAT - family-based association tests
- FastSLINK - conditional simulation of genetic data on pedigrees
- Gassoc - test for linkage between multiallelic genetic markers and disease
- Genehunter - extraction of complete multipoint inheritance information from pedigrees
- GOLD - Graphical Overview of Linkage Disequilibrium
- Grace - WYSIWYG 2D plotting tool
- GRIND - analysis of systems of ordinary differential equations (ODEs) and maps
- Haploview - designed to simplify and expedite the process of haplotype analysis
- HapScope
- homoz - multipoint mapping of disease genes in nuclear pedigrees, including homozygosity mapping
- Intel Fortran compiler
- isPCR In-Silico PCR searches a sequence database with a pair of PCR primers, using an indexing strategy for fast performance.
- Java (Sun and IBM/Blackdown)
- LAMP - software for Linkage and Association Modeling in Pedigrees
- Lahey Fortran compiler
- LINKAGE - a series of programs for maximum likelihood calculation of LOD scores
- Loki - analysis of a quantitative trait observed on large pedigrees using Markov chain Monte Carlo multipoint linkage and segregation analysis
- Madeline - preparing, visualizing, and exploring human pedigree data used in genetic linkage studies.
- mapmaker/sibs - mapping of loci in nuclear pedigrees with two or more affected/phenotyped sibs
- mapmaker (exp/qtl)
- MDR
- Mega2 - data-handling program for facilitating genetic linkage and association analyses
- Mendel - exact statistical analysis of qualitative and quantitative traits
- Merlin - Multipoint Engine for Rapid Likelihood Inference
- Octave - high-level language, primarily intended for numerical computations
- OSA - Ordered Subset Analysis
- PBAT - Tools for the statistical analysis of family-based association studies
- PAP - Pedigree Analysis Package
- PDT - Pedigree Disequilibrium Test
- ped2spl - interfacing of and marker selection from standard LINKAGE input files to SPLINK and TRANSMIT
- Pedcheck - detection of marker typing incompatibilities in pedigree data
- Pedsys - tool for management of genetic, pedigree and demographic data
- PHASE: A program for reconstructing haplotypes from population data
- phrap/consed - DNA sequence assembler and finishing tools
- Prest - detection of pedigree errors by use of genome-screen data
- Pseudomarker - joint Linkage and LD analysis
- QTDT - family based tests of linkage disequilibrium
- QTL Cartographer - suite of programs to map quantitative traits using a map of molecular markers
- R - language and environment for statistical computing and graphics
- RHMAP - statistical package for radiation hybrid mapping
- SAGE - Statistical Analysis for Genetic Epidemiology
- Simped - simulation program to generate haplotype and genotype data for pedigree structures
- SimWalk2 - haplotype, parametric linkage, non-parametric linkage (NPL), identity by descent (IBD) and mistyping analyses
- Solar - genetic variance components analysis
- StepC - Statistical Explanation for Positional Cloning
- Superlink - exact genetic linkage analysis with input-output relationships
- Swig - allows a developer to wrap C/C++ functions for use with scripting languages
- TOPALi - detection of recombination in DNA sequence alignments
- Transmit - transmission disequilibrium testing
- Vitesse - Likelihood Calculation on Pedigrees
- WHAP - SNP haplotype analysis package
Running Jobs in the Background
Many of the programs available on our systems for bioinformatics can take a considerable amount of time to run. Some may take days or even weeks to complete their analysis. For this reason, it may be desirable to place such jobs "in the background." This is a way of running a program that allows you to continue working on other tasks (or even log out) while still keeping the program running. Furthermore, backgrounded jobs are not dependent on your session remaining open, so even if your computer crashes, your job will continue uninterrupted.
NOTE! Due to problematic interactions between OpenMosix kernels and threading used by perl/python/java, you may experience strange and random segfaults when running programs written in these languages. Please use the -g option to bgrun for such programs to prevent them from running on OpenMosix nodes.
There is one consideration you should keep in mind when you're planning to run a job in the background - is it interactive or non-interactive? Interactive jobs require you to provide input after you enter the command. An example of an interactive job is the passwd command - after you enter the command, you have to answer some prompts (ie your password). A non-interactive job is one that doesn't require any further input after entering the command. An example is the ls command - after you enter the command, it does its thing, and then ends.
Non-interactive Jobs
Non-interactive jobs are easy to run in the background and there are several ways to go about it. The best method for most cases is to use the bgrun command to preface your usual command. For example:
bgrun mendel
bgrun is a special program that will take all of it's arguments as a command and submit them to the cluster batch queue. This ensures that the cluster is utilized as efficiently as possible.
After invoking the command, you will be given some information about the job you just submitted, including the identifier and where the output of the program (if any) will go.
your job 8202 ("mendel.31187") has been submitted
Job submitted. Identifier: 31187 ; output redirected to mendel.31187.output
You can check on the status of your submitted jobs by entering the following command:
qstat -u myusername
If your command generates output normally, you can also preview that output by looking at the output file using the tail command. In the example above, you would use tail mendel.31187.output to look at the last 10 lines of that file.
When the job has completed running, you will no longer see the job listed via the qstat command. You can also cancel a job by entering qdel myjobid. The job id is the first number in the bgrun output above, ie 8202.
Once the job is running in the cluster queue, you do not have to remained logged in. You can log out and your job will continue to run.
The bgrun command has a few options itself. They can be seen if you enter bgrun as a command with no arguments. They include -m which will cause bgrun to generate an email message once the job is complete (this requires an email address in your ~/.forward file); -x which will exclude the head node from running the job (it will instead select one of the backing, usually less busy, cluster nodes); and -o OUTFILE which will let you specify a name for the output file instead of the default.
Interactive Jobs
Interactive jobs are harder to run in the background, since if they are running in the background, there is no way for it to receive input from you. However, some interactive programs can be made to run in a non-interactive way. Some, for example, allow you to answer all prompts as a series of command-line options. If this is possible, then you should investigate the options required to do this and then run the command non-interactively.
Other commands can accept input from a file instead of from your direct input. In these cases, you would put all of the answers you would type during the interactive run into file and then "pipe" these answers into the program via input redirection, eg command < input.file. Again, in this case, you can then run the command as if it were non-interactive.
If there is no way to make a program run in a non-interactive fashion, you can essentially background your entire session using the screen command. To do so, you have to first initialize a screen session by entering screen. It will look like nothing happened. Now run your interactive job. Once you have provided all required inputs and the job has begun to run, you can background the entire session by pressing Control-A followed by D. If you do this successfully, you should see a [detached] message to indicate your session was put in the background.
At this point, you can log out.
To re-attach your session, enter screen -r. Your session should pick up right where it left off. If your job is complete, you can close out your session by entering exit. Remember to close out all screen'd sessions! You can see a list of all your screen sessions via screen -list.
The Human Genetics Computational Cluster
Human Genetics provides computational services for bioinformatics. This comes in the form of Unix servers with bioinformatics software installed and configured in a cluster to handle the needs of our users. The number and specifications of the cluster varies (ie increases) over time, but as of this writing (2007-06-15) consists of 20 "nodes" of dual processor computers of 2.4 - 2.8 GHz each CPU, for a total of 96 effective GHz.
Please note that some nodes are available only through Grid Engine See below for details on how to use the Grid Engine.
NOTE! Due to problematic interactions between OpenMosix kernels and threading used by perl/python/java, you may experience strange and random segfaults when running programs written in these languages. Please use the -g option to bgrun for such programs to prevent them from running on OpenMosix nodes.
While there may be many and variable numbers of nodes available, users connect to only one of them, called the "head node". This head node is named calypso and has the full hostname calypso.genetics.ucla.edu. This is the server to which users log in and run software.
How the cluster works
Two clustering technologies are employed by the Human Genetics cluster. They each have their benefits and while they function well together, they are separate entities and the in and outs of each should be kept in mind.
openMosix
The easiest clustering technology to use is called openMosix. You don't have to do anything special to use it as it is completely transparent. Just run your programs or "jobs" as if no clustering were involved and openMosix will automatically transfer and run it on the best possible node. In fact, it may move your job again across nodes if another one becomes available and it might run faster there.
As openMosix is transparent to the user, your jobs can be monitored and managed via the usual Unix tools. For example, the process list command ps will list your processes as if they were running on calypso, even if they are actually running on another node. Likewise top will monitor running processes.
In addition to the regular Unix tools, openMosix includes a few extra tools that provide additional details and insight into the functioning of the openMosix cluster. mtop is a replacement for top that is openMosix-aware: in addition to the normal information, it also lists on which node a job is running, and how many times it has moved from node to node. mtop should be used on our cluster instead of top for this reason.
mosmon is another tool and it provides a pseudo-graphical monitoring display of cluster load, using a histogram. With it, you can see a visual representation of how many openMosix nodes are available and the relative load on each of them. Enter mosmon -h to see a detailed description of what mosmon can do as well as a list of keyboard commands available to alter the display while it is running.
One caveat with openMosix cluster is that not all jobs will migrate to different nodes and instead will "stick" on the head node. While this is unusual, it is still something to be mindful of as it would be ill-advised to run 10 jobs of this type since they will swamp the head node rather than distributing across the cluster. Whether this will happen depends on the program you're running and the specifics of a particular job, so it's hard to know in advance if this will be the case - please monitor using the above tools (mtop is a good choice) to see that your jobs are distributing properly.
The other caveat with the openMosix cluster is that not all cluster nodes are openMosix members - when using openMosix as the way to distribute jobs, only a subset of computers are available to you. To gain access to the full suite of cluster nodes, you must use the other clustering technology - the grid engine.
Grid Engine
The other clustering technology employed by our cluster is provided by the N1 Grid Engine. Unlike openMosix, the grid engine is not transparent and you must execute special commands in order to utilize the grid engine cluster. Also unlike openMosix, the grid engine doesn't run all jobs it receives simultaneously - rather it runs as many jobs as there are CPUs available and "queues" the others until a CPU becomes available. As such, the grid engine is more "friendly" to all users in that one user cannot swamp the cluster and in practice, the time to complete jobs run serially is not significantly different than if run simultaneously.
To utilize the grid engine, you must "submit" jobs to the grid engine queues. This is most easily done through the bgrun command - usage details for this command are available here
Monitoring jobs in the grid engine system requires the use of some new commands. The most useful are qhost, which lists all members of the grid engine cluster and their current loads; qstat which lists details on the current queue (which jobs are queued or running and where they are running); and qdel which allows you to remove unwanted jobs from the queue (you can only remove your own jobs, of course).
While using the grid engine does involve the use of an extra command, in practice, this should be as easy to use as with openMosix - simply preface your usual command with "bgrun" (eg bgrun mendel instead of just mendel). The benefits of using the grid engine is that unlike openMosix, you will have full access to all members of the cluster and that it is able to better distribute jobs in an efficient manner. Not only will all jobs distribute under the grid engine, it does so in a more load-balanced manner. Furthermore, with the Grid Engine, you have a better chance of not losing your job if the head node goes down.
Getting Started with Genotator
Genotator is a program that allows you to perform a variety of different sequence analyses[1] at once and examine the various outputs in a unified form. Additional information about Genotator and the details about its functions and usage can be found at http://www.fruitfly.org/~nomi/genotator/.
This HOWTO covers getting started with using Genotator and running a typical analysis. For details and in depth discussion on subsequent examination of the results, please consult the documentation provided at the site linked above.
Note: Genotator requires an X-Windows connection to our servers. Please see our XWin HOWTO for details.
Running the analysis
Genotator runs in two stages - first the analysis, then the examination of the analysis. To run an analysis, prepare your sequence in fasta format. It should look something like this:
>MyDrosSeq
agttgtactgaaatactcgataaggaaatacccaaattacaaaatgttcaagcacctgctgactttgttc
gccctgtgcgcggtgtttagcacctgcctgtcggaagacgagacccgtgcccgtctcctggtctctaagc
agatcctgaacaagtacctggtggagaagagcgacctgttggtacgctacaccatcttcaacgtgggcag
To start genotator, enter genotator at the command-line. You will then be presented with the main genotator analysis window.
First, press the PRESS HERE TO SELECT button to browse to your fasta format sequence file. Select the organism from which your sequence originates, the select the analyses you wish to have performed [1] (green means include).
For the output option, make sure to select Current directory, as you will not have write privileges to the default selection and Genotator will fail.
Finally, press the Start annotation button to begin the analysis- you will be presented with a notice about the run - press OK to start.
Depending on current load on the server, the analyses may take a few minutes. Once it has completed, the genotator will disappear and you will be returned to the command prompt and a message informing you on how to view your results.
Browsing your results
To browse your results, enter genotator-browser my_sequence.tfa, replacing my_sequence.tfa with whatever was indicated by Genotator's closing message. You do not have to type in the full paths.
A colorful window summarizing the results of the various analyses performed will appear. You can click on the color bars to get details on particular results, and in some cases double-click to view details from the originating output files.
It is beyond the scope of this HOWTO to describe completely the usage of the genotator-browser, so please consult the official documentation for further elaboration.
To quit, select Quit from the File menu.
Notes on the programs used by Genotator
As of 2002-11-06, the Grail component does not work as the Grail server is not available.
Promoter prediction is provided by fa2TDNNpred. tRNA scanning is performed by tRNAscan-SE.
Homology searches are the result of blastx performed against the indicated databses. Please note that the installed databases may not be current at a given time.
HOWTOs Appendices
Human Genetics Computing Support
Apply for an Account
There are a number of different services available here at Human Genetics.
To log onto most of the computers in the labs you'll need an account on our Gonda Windows Network. This account provides you with file space, print service, and computer lab use.
We also have a Linux cluster for research purposes. To access our linux cluster, you'll need an account on our Calypso Linux server.
You can also have a mednet email account (i.e. name@mednet.ucla.edu). This email account is for people associated with the UCLA School of Medicine or the UCLA Medical Center.
For access to one or more of these, please fill out the
---> Human Genetics New User Application <---
Please submit all applications to 4558 Gonda Center or the mailbox of Computer Support Office. An introductory pamphlet will be provided which gives you an overview of our various resources available to you.
Submit your technical support request here! This will ensure that your request is properly logged in our system.
The Team
Our Office is at the Gonda Research Center, Room 4558. Group members are:
- Clifford Kravit
- x7-2727
- Sharon Tang
- x7-2453
- Dat Huynh
- x5-7449
If you have any technical support needs, please submit your request via our Online Helpdesk to ensure that it is received and assigned timely.
Our general mailbox is support@genetics.ucla.edu.
We've set up a number of pages to help out with common problems and initial set-up issues. If you have a suggestion for a new HOWTO, please email us.
Free Software
Free Software We Recommend
This is a list of software that is completely free (or even open source) that we feel may be of use to our users.
Internet
Web
- FireFox (Windows) is a browser that doesn't suck. We highly recommend it for Windows users as the default Windows browser is very problematic.
- Nvu (Macintosh/Linux/Windows) is a graphical web page authoring program, based on the Composer component of the Mozilla suite. It aims to be a replacement for Dreamweaver or FrontPage.
Mail
- Thunderbird (Linux/Macintosh/Windows) is an email client with spam filtering, quick search, RSS news reader, and much more. It does not work with Exchange (considered a feature by some), but does work with any IMAP/POP account.
- Sylpheed Claws (Linux/Windows) is an email client that offers a host of features geared towards advanced users but after initial setup is quite easy to use. It works with all Internet standard protocols (some features of Microsoft's proprietary Exchange protocol may not be available).
Other Connections
- Putty (Windows) is an command line ssh client.
- WinSCP (Windows) is a graphical scp/sftp file transfer utility.
- Fugu (Macintosh) is a graphical scp/sftp file transfer utility.
- Cyberduck (Macintosh) is a graphical ftp/sftp file transfer utility
- Trillian (Windows) is a multi-protocol (AIM, Yahoo, MSN, IRC, etc.) instant messaging client.
- Gaim (Linux/Macintosh/Windows) is a multi-protocol (AIM, Yahoo, MSN, IRC, etc.) instant messaging client.
Utilities
- 7-Zip (Windows) is a utility that handles zip compression as well as a number of other file compression formats.
- MacOS X comes with a builtin zip utility available from the command line (ie Terminal). For those who fear such mysticism, Zippist provides a graphical interface.
- PDF Creator (Windows) is a driver that allows you to print documents to PDF files. (download here, get the GNUGhostScript one)
- Antidote SuperLite is a simple, run-once virus checker.
Text Editors
- Notepad2 (Windows) and Metapad (Windows) are both editors for those who are stuck on Windows and have outgrown the limitations of Microsoft's Notepad. Both handle the cross-platform compatibility in a more robust way and provide extra features for programmers.
Media
- Videolan Client (VLC) (Macintosh/Linux/Windows) is a video/movie player that handles many media files that the OS's builtin player often will not. It plays DVD/SVCD/VCD too.
- iTunes (Macintosh/Windows) is a digital jukebox that helps you organize and play your music. An iPod is not required ... but highly desirable.
- IrfanView is a feature-rich image viewer and manipulator for Windows. Fast Stone Image Viewer is another one.
Productivity
- OpenOffice (Macintosh/Linux/Windows) is an office productivity suite (word processor, spreadsheet, drawing) modelled after Microsoft Office.
- AbiWord (Macintosh/Linux/Windows) is a word processor.
- Inkscape (Macintosh/Linux/Windows) is a vector-based drawing tool (like Adobe Illustrator)
Internet Services
- GMail is a free web-based email service provided by Google. It offers 1GB mail storage, spam filter, and a unique "conversation" based interface to your email. Please ask us if you would like an invitation to an account.
- YouSendIt is a convenient way to send someone a file that is too large for email. Just upload your file and specify the email address of your recipient. Dropload is a similar service that requires registration. This page provides a comprehensive listing of similar services.
- FastMail is an email service that is fast, reliable, and has a clean interface. The free account provides 10 MB storage, webmail, and IMAP.
- Jetable, SneakEmail, and PookMail provide temporary/anonymous email addresses that you can use when you don't want to give your real address out. They all work a little different, try them out!
- del.icio.us is an online bookmark manager. It allows to you save and "tag" bookmarks online so that they are available on any net-connected computer. Tagging allows for easy search and retrieval of your bookmarks.
- MyPunBB hosts message boards (forums) for free.
Software Listings
Human Genetics FAQ
- Why can't I log in?
- There are many reasons this may be occurring. First check that your username and server name settings are correct. Note that having one username on one service doesn't not necessarily mean that you have the same username elsewhere. If both of these appear to be correct, then it is likely that your password doesn't match the one expected. It is not possible for us to recover passwords so you will need to have it reset by dropping by the Computer Support office.
- How do I change my Gonda login password?
- How-to guide available here
- How can I change my MEDNET email password?
- To change your MEDNET email password, you may go to this link directly:
https://www.mednet.ucla.edu/ChangePassword/
-
There is also a how-to guide available here.
- This guide shows you how to change your MEDNET email login password, it's used when you voluntarily want to change the password, or when you're prompted that your old password has expired or about to expire. Please see information on the Mednet email policy here
- I was locked out of my MEDNET email account, what should I do?
-
Some of you may have had your email account "locked out" by typing in an incorrect password 3 times, or had it expired (those new users logging onto the AD domain) and needed a reset. To help expedite resetting your Mednet email password, you may call the MCCS Enterprise Helpdesk number at 310-794-Help for simply 4help from a campus phone. They're open 24/7 and can help you with the reset. This is especially useful for AD users, while MEWWEX accounts are automatically unlocked after 15 mins. To find out what policy applies to your account, please go to: MEDNET policy
- I want to send my colleague a 50MB PowerPoint presentation but when I try to email it, it gives me an error.
- Email is not meant for transfer of large files- it is grossly inefficient and stresses servers unnecessarily. File transfers can be accomplished via upload sites. Human Genetics researchers can use our in house service. Other parties, such as YouSendIt and Dropload provide similar services.
- What software is available on calypso?
- In additional to the usual set of general Unix programs, calypso has a large number of bioinformatics software available. Please see the list of bioinformatics software for a complete list.
- My perl/python/java scripts keeps segfaulting on calypso, at different times- why?
-
This is due to a problematic interaction between the openmosix clustering capabilities and high level scripting languages. Please use the bgrun with the -g option or nomig wrappers to mitigate the problem.
- Can you install Adobe Acrobat on my computer so I can create PDFs?
- Acrobat is commerical software and we do not have an Acrobat site license for Human Genetics. It is available on some of the computers in the Bioinformatics labs (5th floor Interaction Zone) and on Titan. Other than using it on one of those computers, you will need to purchase it through your preferred vendor (the UCLA computer store sells it for around $100).
- One free option is PDF Creator, which functions as a printer driver to create PDF files.
-
Macintosh computers running MacOS X have built-in support for PDF creation, so if you have access to such a computer, that may be another option (there are two in the 5th floor Interaction Zone). Just choose the "Save as PDF" option from any print dialog.
HOWTO HOWTO
This page is for Administrators. If you are not one, then you shouldn't be reading this. We will check our logs periodically and if (I mean when) we find out you were reading something you weren't supposed to, we will make your life very hard.
Note: always keep in mind that the Helpdesk and Howtos are cross-department. While sometimes a HOWTO has to contain department specific information, please do your best to keep it general when possible
Note: do not ever use Word in any authoring of content. At no time should text that ends up here have ever been in Word. Don't think I can't tell.
Now, I assume you are logged in. In the navigation menu, probably on the left, look for the create content link. Click it.
The HOWTOs are organized in a Drupal "book", so click book page.
Now for the real work. Give your HOWTO a descriptive name. This will appear as the main heading of the page, at the top. The path alias is important, too. It is used as the URL for the page. NO SPACES. Just letters and underscores if you need them. Something like howto_howto, for example.
The Parent setting is important for organization. Pick a section under which your HOWTO will appear. If you are creating a new section, then this will be a section page and then you have to create another page for the actual HOWTO.
If you have images to attach to your HOWTO, now is the time to do it. Do it before you enter anything in the body. First, make sure your images have sane names - they go into one directory, so use naming such as "topic_picture1.png" so that all of the images for a given page can be easily discerned and will be less likely to collide with others. Once they are ready, go to the bottom of the edit page and Browse and Attach. In the table that appears listing the attachments, turn off the check box under "List". It is annoying. Your body now has junk appended to it. Ignore it for now. Just keep browsing, attaching, and unchecking that little box and watching the body junk grow and grow. Ponder why the Drupal devs did it this way, overloading the body field. Maybe you can think of a reason why this is not dumb.
Now for the body of the HOWTO (if you have attached images, you'll need to delete all the accrued junk). You have a choice of 2 different input methods - Filtered or Full. Full means all the HTML you want to use. Obviously it is powerful, but it takes a bit more work. Filtered means that you don't have to type in HTML if you don't want to (though a select few tags are available), and Drupal will try to format for you. For absolute control, use Hardcore. Unlike Full, not even line breaks are touched when you use Hardcore. This, btw, is a custom input format I created for myself.
Unfortunately, it looks like you have to use Full mode if you want to embed images. Anyway, try out either, using the Preview button. Notice that Drupal actually changes stuff and sticks <br> tags and condenses white space. Notice how annoyed you are that it is doing that. Oh well.
As always, it is good practice to use properly structured/semantic HTML. So use <h2> for major headings, <h3> for minor, etc. <h1> is for the title, so you shouldn't use it in your body. If you have images, make a note of the URL Drupal has given the image (in the table of attachments at the bottom) and drop the top level of the URL and use something like this:
<img src="files/file_name.png" class="screen" /> Blah
The class="screen" will make it float to the right of the paragraph and give it a nice border. You may have to use style="clear:both" on subsequent paragraphs to break the float - play around.
Some other CSS snippets you may want to use:
Once you are done with the body text and satisfied by the preview, submit it. Make sure you have removed any of the extra junk Drupal keeps appending to the your body.
That should do it! If you have questions, it's good to go look at one of the others that are already done. See this one, for example. It has pictures attached.
Finally, you should check that your HTML is valid. The validator is at http://validator.w3.org/.
